PCR:	Mfg-LTb
Name of Positive CTRL:	Mfg-LTb
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	30 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	LT b rev	230	100 µM	10.0 µl for 1ml	aggccagcacagccaggaca
	Mfge8 E1 3 up	248	100 µM	10.0 µl for 1ml	CACTTCAGCCCTCCCTCTTC
Expected Bands:	Band Size: 300.0	Description: unspB6ctrl	(text displayed in the image)
	Band Size: 330.0	Description: 330Mfg-LTb	(text displayed in the image)
	Band Size: 500.0	Description: 500 actin	(text displayed in the image)
More Information in PDF:		view PDF