PCR:	MFGE8 wt/ko
Name of Positive CTRL:	MFGE8 wt/ko
Annealing Temperature:	57.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	MFG-E8 antisense	246	100 µM	40.0 µl for 1ml	GGGCATAAACTCCAGCTCAC
	MFG-E8 ko sense	249	100 µM	20.0 µl for 1ml	CGTGGGATCATTGTTTTTCT
	MFG-E8 wt sense	250	100 µM	20.0 µl for 1ml	GTGAACCTTCTGCGGAAGAT
Expected Bands:	Band Size: 350.0	Description: 350 ko	(text displayed in the image)
	Band Size: 600.0	Description: 600wt	(text displayed in the image)
More Information in PDF:		view PDF