PCR:	Ltbr lox
Name of Positive CTRL:	Ltbr lox
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	45 s
Hot Start:	HS 57
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	351	79	100 µM	10.0 µl for 1ml	CAGTGGCTCCAAGTGGCTTG
	352	80	100 µM	10.0 µl for 1ml	GCAAACCGTGTCTTGGCTGC
Expected Bands:	Band Size: 310.0	Description: 310 wt	(text displayed in the image)
	Band Size: 380.0	Description: 380 ko	(text displayed in the image)
More Information in PDF:		view PDF