PCR:	gpi44 ko
Name of Positive CTRL:	gpi44 ko
Annealing Temperature:	60.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	HS 65
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	GPIneg2037 fw	183	100 µM	10.0 µl for 1ml	aaccgttacccacctcagggt
	GPIneg2037 rev	184	100 µM	10.0 µl for 1ml	cagggcgcctcgagacgcgtca
	m28s rDNA 225 F	390	10 µM	10.0 µl for 1ml	CAG ACG TGG CGA CCC GCT GA
	m28s rDNA-225 R	276	10 µM	10.0 µl for 1ml	GCC TCA CAC CGT CCA CGG GC
Expected Bands:	Band Size: 225.0	Description: 225 m28	(text displayed in the image)
	Band Size: 600.0	Description: 600 gpi ko	(text displayed in the image)
More Information in PDF:		view PDF