PCR:	Dicer Floxed
Name of Positive CTRL:	Dicer Floxed
Annealing Temperature:	62.0 °C
Number of cycles:	40.0
Extension Time:	35 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	(DF2) DR1	92	100 µM	10.0 µl for 1ml	catgactcttcaactcaaact
	DF1	157	100 µM	10.0 µl for 1ml	cctgacagtgacggtccaaag
Expected Bands:	Band Size: 350.0	Description: 350 wt	(text displayed in the image)
	Band Size: 400.0	Description: 400 ko	(text displayed in the image)
More Information in PDF:		view PDF