PCR:	DhhCre
Name of Positive CTRL:	DhhCre
Annealing Temperature:	55.0 °C
Number of cycles:	35.0
Extension Time:	40 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	Actin fwd	114	100 µM	10.0 µl for 1ml	TGT TAC CAA CTG GGA CGA CA
	Actin rev	115	100 µM	10.0 µl for 1ml	GAC ATG CAA GGA GTG CAA GA
	DhhSenseNeu	159	100 µM	20.0 µl for 1ml	gcggtgctctttagctcctgcgg
	tg63neuAS02	35	100 µM	20.0 µl for 1ml	catcactcgttgcatcgaccgg
Expected Bands:	Band Size: 200.0	Description: 200	(text displayed in the image)
	Band Size: 550.0	Description: 550 Actin	(text displayed in the image)
More Information in PDF:		view PDF