PCR:	CD8
Name of Positive CTRL:	CD8
Annealing Temperature:	62.0 °C
Number of cycles:	35.0
Extension Time:	35 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	oIMR1098	209	100 µM	20.0 µl for 1ml	gacctggtatgtgaagtgttgg
	oIMR1099	210	100 µM	10.0 µl for 1ml	acatcaccgagttgctgatg
	oIMR1100	211	100 µM	10.0 µl for 1ml	gctatcaggacatagcgttgg
Expected Bands:	Band Size: 350.0	Description: 350	(text displayed in the image)
More Information in PDF:		view PDF