PCR:	CD4
Name of Positive CTRL:	CD4
Annealing Temperature:	57.0 °C
Number of cycles:	35.0
Extension Time:	60 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	CD4 F1	139	100 µM	10.0 µl for 1ml	cctcttggttaatgggggat
	CD4 F2	140	100 µM	10.0 µl for 1ml	tttttctggtccagggtcac
	CD4 R	141	100 µM	20.0 µl for 1ml	gtgttgggtcgtttgttcg
Expected Bands:	Band Size: 250.0	Description: 250	(text displayed in the image)
More Information in PDF:		view PDF