PCR:	ATG line
Name of Positive CTRL:	ATG line
Annealing Temperature:	65.0 °C
Number of cycles:	40.0
Extension Time:	60 s
Hot Start:	Not yet
Primers:	Primer:	ID:	Working Stock Concentration:	Volume:	Sequence (5'-3'):
	check2	68	100 µM	20.0 µl for 1ml	acaacgtcgagcacagctgcgcaagg
	mTUBB5-247 F	277	100 µM	10.0 µl for 1ml	CGG CCA CCA TGA GCG GCG TC
	mTUBB5-247 R	392	100 µM	10.0 µl for 1ml	GTG AGG TAC CGG CCG TGG CG
	short2	66	100 µM	20.0 µl for 1ml	gtactgcataatggtttaactcttgc
Expected Bands:	Band Size: 249.0	Description: 249mTUBB	(text displayed in the image)
	Band Size: 700.0	Description: 700	(text displayed in the image)
More Information in PDF:		view PDF